20 Birth of myostatin-edited calf generated by cloning using CRISPR-Cas9 protein technology

Some European cattle breeds, such as Charolais and Maine Anjou, present natural mutations in the exon 2 of myostatin (MSTN) gene that produce a dysfunctional protein and generates a “double muscle” trait. This natural mutation can be reproduced by gene editing, accelerating the conventional breeding progress (precision breeding). We have previously produced MSTN-edited embryos through disruption of the MSTN gene expression in bovine fetal and adult fibroblasts combined with somatic cell nuclear transfer (SCNT) technology. Now, we aimed to obtain edited offspring with a valuable genetic background. To achieve this, 1 × 10⁵ mesenchymal stem cells (MSCs) from a prize-winning cow were nucleofected (1240 V-30 msec-1 pulse) with 3 µg of Cas9 protein and 750 ng of a sgRNA previously assessed to target exon 2 of the bovine MSTN gene (AACCCATGAAAGACGGTACA). Then, the targeted site was amplified by PCR and Sanger sequenced for InDels occurrence analysis with the ICE-Synthego software tool. The edition efficiency was calculated as the proportion of modified sequences in MSTN-edited MSCs (edit-MSC group) compared to wild-type MSCs (wt-MSC group), obtaining 59% of gene edition in edit-MSCs, 56% of which consisted of an adenine base addition. These cells were then used as nuclear donors for standard zone-free SCNT procedures. Briefly, zone-free mature oocytes were mechanically enucleated, cytoplasts and donor MSCs were electrofused, and, after 2 h, the reconstructed oocytes were activated with 5 µM Ionomycin for 4 min followed by 10 mg/mL of cycloheximide combined with 0.5 μg/mL of cytochalasin B in SOF for 5 h. Zygotes were individually cultured in a well of the well system, covered in SOF. Cleavage and blastocyst formation were evaluated after 3 and 7 days of in vitro culture, respectively. Considering the main aim of obtaining an edited calf, two cloning repeats were performed using edit-MSC and one using wt-MSC. Cleavage and blastocyst rates were analysed by chi-squared test and pregnancy rate by Fisher test (P < 0,05). Cleavage rates of SCNT embryos were 83.6% (351/420) and 86.8% (66/76) in edit-MSC and wt-MSC groups, respectively. Blastocyst rates were 25.2% (106/420)^a and 44.7% (34/76)^b in edit-MSC and wt-MSC groups, respectively. Six embryos from the edit-MSC group were used to evaluate MSTN edition by Sanger sequencing: 4 were edited (66.7%, one base insertion) and 2 were wild type (33.3%). One edited embryo showed homozygous biallelic edition (1/4, 25%) and 3 presented monoallelic edition (3/4, 75%). Embryo transfer resulted in the birth of two calves, one from edit-MSCs (n = 35 ET, 2.9%) and one from wt-MSCs (n = 17 ET, 5.9%). Sequencing of the born animal from the edit-MSC group showed biallelic edition with an A insertion in one allele and an 18-base deletion in the other. Off-target analyses revealed no untargeted edition. Moreover, this animal was re-cloned from a fibroblast cell sample, and one ongoing pregnancy was obtained. These results show that gene editing could be applied in breeding programs as an alternative to conventional cross-breeding.